Klk1b1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klk1b1^em1(IMPC)J
• Name: kallikrein 1-related peptidase b1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7768079
• Gene: Klk1b1 Location: Chr7:43616175-43620742 bp, + strand Genetic Position: Chr7, 28.44 cM
• Alliance: Klk1b1^em1(IMPC)J page
• IMPC: Klk1b1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATCCCTTACCACAGCCAGGA and ATTGGGTATCACACTCTAGT. This resulted in a 4,734 bp deletion of Chr7:43,966,617-43,971,350 (GRCm38/mm10) that removes exons ENSMUSE00001056438 and/through ENSMUSE00000470956. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Klk1b1 Mutation: 28 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)