Mis18a^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mis18a^em1(IMPC)Ics
• Name: MIS18 kinetochore protein A; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:7781791
• Gene: Mis18a Location: Chr16:90516200-90524259 bp, - strand Genetic Position: Chr16, 51.87 cM, cytoband C3.3
• Alliance: Mis18a^em1(IMPC)Ics page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to TGGGAAGTGGGGTACTCCCG, TCCCGTGGTTCAGCACTAAA,TGGTGATAGCCCCTTAAGAT and AGCCCCTTAAGATCGGAAAG), resulting in a 548 bp deletion that includes exon 2 (ENSMUSE00001224879; GRCm39), leading to a frameshift and premature stop codon. (J:358405)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mis18a Mutation: 13 strains or lines available

References

• Original: J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024
• All: 1 reference(s)