Kcnj15^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnj15^em1(IMPC)Ics
• Name: potassium inwardly-rectifying channel, subfamily J, member 15; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:7781815
• Gene: Kcnj15 Location: Chr16:95058417-95101119 bp, + strand Genetic Position: Chr16, 55.86 cM
• Alliance: Kcnj15^em1(IMPC)Ics page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to ATATAGTTATTGCATGCGGT, TATATTTAGTCTTATGGCAC,CCACGAACGTCTGTGTGATT and CGTCTGTGTGATTTGGTAGT), resulting in a 1325 bp deletion that includes part of exon 4 (ENSMUSE00001264674; GRCm39), leading to a frameshift and premature stop codon. (J:358405)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnj15 Mutation: 28 strains or lines available

References

• Original: J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024
• All: 1 reference(s)