Cbr1b^em1(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cbr1b^em1(IMPC)Ics
• Name: carbonyl reductase 1B; endonuclease-mediated mutation 1, Mouse Clinical Institute
• MGI ID: MGI:7781817
• Synonyms: Gm5678^em1(IMPC)Ics
• Gene: Cbr1b Location: Chr16:93424985-93427339 bp, + strand Genetic Position: Chr16, 54.54 cM
• Alliance: Cbr1b^em1(IMPC)Ics page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 4 sgRNAs (equivalent to CCTCATCAAAGGGTTTGCA, AAGGAGATCAGGCCTTAAGC, TTACGGGGTAGGACTCCTT and TATTTGCAGGGTAGGTTACG), resulting in a 2814 bp deletion that includes the proximal promoter and exons 1 and 2 (ENSMUSE00000720738 and ENSMUSE00001039070; GRCm39), leading to the absence of protein. (J:358405)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cbr1b Mutation: 5 strains or lines available

References

• Original: J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024
• All: 1 reference(s)