Mir678^em2(IMPC)Ics
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mir678^em2(IMPC)Ics
• Name: microRNA 678; endonuclease-mediated mutation 2, Mouse Clinical Institute
• MGI ID: MGI:7781827
• Gene: Mir678 Location: Chr10:76043160-76043243 bp, - strand Genetic Position: Chr10, 38.74 cM
• Alliance: Mir678^em2(IMPC)Ics page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: This allele was generated at the Institut Clinique de la Souris by electroporating Cas9 protein and 2 sgRNAs (equivalent to ATGTCCGCATCTTGTGTCAG and CTACCCATGCAGAGTCCACT) and a 451 nt ssODN template, resulting in the introduction of loxP sites flanking the single exon (ENSMUSE00000660428; GRCm39) located in the Prmt2 3' UTR. (J:358405)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mir678 Mutation: 3 strains or lines available

References

• Original: J:358405 MGI and ICS/MCI, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC) Generated by ICS/MCI. Database Release. 2024
• All: 1 reference(s)