Mmp1b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mmp1b^em1(IMPC)J
• Name: matrix metallopeptidase 1b (interstitial collagenase); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7787086
• Gene: Mmp1b Location: Chr9:7368239-7388047 bp, - strand Genetic Position: Chr9, 2.46 cM, cytoband A1-A2
• Alliance: Mmp1b^em1(IMPC)J page
• IMPC: Mmp1b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGGGTAGAGGGGACCTGTGA and TTAGAAAATACTGCAGTCCC. This resulted in a 1,598 bp deletion of Chr9:7,386,141-7,387,738 (GRCm38/mm10) that removes exon ENSMUSE00000302943, ENSMUSE00000983617 and ENSMUSE00000302891. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mmp1b Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)