Smg9em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Smg9em1(IMPC)J |
| Name: |
SMG9 nonsense mediated mRNA decay factor; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5616624 |
| Synonyms: |
Smg9em1J |
| Gene: |
Smg9 Location: Chr7:24099106-24122197 bp, + strand Genetic Position: Chr7, 10.54 cM
|
| Alliance: |
Smg9em1(IMPC)J page
|
| IMPC: |
Smg9 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Hypomorph) |
| Mutations: |
|
Insertion, Intragenic deletion
|
| |
|
Mutation details: This allele from project Smg9-6001-MP6R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTACGGGATAGAGCGGCGG, which resulted in a 2 bp deletion GG and a 10 bp insertion CTGGGTTCTA in exon 2 beginning at Chromosome 7 positive strand approximate position 24,403,446 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 15 and early truncation 88 amino acids later. QRT-PCR confirmed a severe reduction in transcript expression.
(J:188991, J:231968)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|
Analysis Tools
