About   Help   FAQ
Spata13em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Spata13em1(IMPC)H
Name: spermatogenesis associated 13; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6153824
Gene: Spata13  Location: Chr14:60871450-61002005 bp, + strand  Genetic Position: Chr14, 31.77 cM
Alliance: Spata13em1(IMPC)H page
IMPC: Spata13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences TGCGAAACACTTCCCTACTCTGG, GCCATATAGATTGGTGGCAGTGG, GCTAGATGCCGGTGTAGGTTTGG, CCACGGCATGAAAGCTAGATGCC, which resulted in a Exon Deletion. Sequencing of F0 animals revealed an individual with a 716 nt deletion encompassing ENSMUSE00000122772 of Spata13 resulting in a frameshift and premature stop codon in the following exon. (J:237616, J:274791)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Spata13 Mutation:  79 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/19/2024
MGI 6.24 		The Jackson Laboratory