Mtorem1Vic
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mtorem1Vic |
| Name: |
mechanistic target of rapamycin kinase; endonuclease-mediated mutation 1, Gabriel Victora |
| MGI ID: |
MGI:6295460 |
| Synonyms: |
MtorF2108L |
| Gene: |
Mtor Location: Chr4:148533068-148642140 bp, + strand Genetic Position: Chr4, 78.76 cM, cytoband E1
|
| Alliance: |
Mtorem1Vic page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Applicable) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: CRISPR-targeting of exon 45 with an sgRNA (targeting GATCTCAAAGCAGCTACCCC) and an ssODN template engineered nucleotide substitutions to produce a G-to-C silent mutation creating an AfIII reaction enzyme site, C-to-A resulting in the amino acid substitution of phenylalanine with leucine at position 2108 (p.F2108L) and several silent mutations to prevent Cas9 recutting. The amino acid substitution produces rapamycin resistance in the encoded peptide.
(J:259205)
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Mtor Mutation: |
115 strains or lines available
|
|
| Original: |
J:259205 Ersching J, et al., Germinal Center Selection and Affinity Maturation Require Dynamic Regulation of mTORC1 Kinase. Immunity. 2017 Jun 20;46(6):1045-1058.e6 |
| All: |
2 reference(s) |
|
Analysis Tools
