Atp8a2^wl
Spontaneous Allele Detail

Summary

• Symbol: Atp8a2^wl
• Name: ATPase, aminophospholipid transporter-like, class I, type 8A, member 2; wabbler lethal
• MGI ID: MGI:1856271
• Synonyms: Wl
• Gene: Atp8a2 Location: Chr14:59884980-60324363 bp, - strand Genetic Position: Chr14, 31.49 cM
• Alliance: Atp8a2^wl page

Mutation origin

• Strain of Origin: STOCK Grxcr1^pi

Mutation description

• Allele Type: Spontaneous
• Mutation: Intragenic deletion
• Mutation details: Spontaneous deletion of 21 bp (agccatcgaagaccgtcttca) in exon 22 results in elimination of seven highly conserved amino acids (AIEDRLQ) from the nucleotide-binding domain (N-domain). (J:188127, J:222308)
• Inheritance: Recessive

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atp8a2 Mutation: 74 strains or lines available

References

• Original: J:13068 Dickie MM, et al., A juvenile wabbler-lethal in the house mouse. J Hered. 1952;43(6):283-286
• All: 12 reference(s)