Flt3^tm1Dgg
Targeted Allele Detail

Summary

• Symbol: Flt3^tm1Dgg
• Name: FMS-like tyrosine kinase 3; targeted mutation 1, D Gilliland
• MGI ID: MGI:3763385
• Synonyms: Flt3^ITD, FLT3/ITD
• Gene: Flt3 Location: Chr5:147267551-147337299 bp, - strand Genetic Position: Chr5, 86.88 cM, cytoband G3
• Alliance: Flt3^tm1Dgg page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:126003
• Parent Cell Line: R1 (ES Cell)
• Strain of Origin: (129X1/SvJ x 129S1/Sv)F1-Kitl⁺

Mutation description

• Allele Type: Targeted (Humanized sequence)
• Mutations: Insertion, Intragenic deletion
• Mutation details: The human W51 mutation which causes the duplication of amino acid 595 to 601 (REYEYDL; AGAGAATATGAATATGATCTC) was inserted in-frame into exon 14, replacing the endogenous single copy (RDYEYDL; AGGGACTATGAATATGACCTT). A loxP site flanked neomycin selection cassette was inserted into intron 15. (J:126003)

Disease models

Expression

In Mice Carrying this Mutation:	2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	4 anatomical structure(s)

Tumor Data

List all tumor models in MMHCdb carrying Flt3^tm1Dgg

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 8 strains available Cell Lines: 0 lines available
• Carrying any Flt3 Mutation: 90 strains or lines available

References

• Original: J:126003 Lee BH, et al., FLT3 mutations confer enhanced proliferation and survival properties to multipotent progenitors in a murine model of chronic myelomonocytic leukemia. Cancer Cell. 2007 Oct;12(4):367-80
• All: 67 reference(s)