Npm1^tm1Gsva
Targeted Allele Detail

Summary

• Symbol: Npm1^tm1Gsva
• Name: nucleophosmin 1; targeted mutation 1, George S Vassiliou
• MGI ID: MGI:5004857
• Synonyms: Npm1^flox-cA
• Gene: Npm1 Location: Chr11:33102287-33113206 bp, - strand Genetic Position: Chr11, 19.21 cM
• Alliance: Npm1^tm1Gsva page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:172071
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: Not Specified

Mutation description

• Allele Type: Targeted (Conditional ready, Humanized sequence)
• Mutations: Insertion, Intragenic deletion
• Mutation details: A loxP site was inserted into intron 10 and a puromycin resistance gene cassette, a second loxP site and a modified exon 11 into intron 11. The exon modification involves replacing the end of the endogenous coding sequence and start of 3' UTR with the equivalent sequence for the human A variant of NPM1, which has a frameshift and slightly longer translated sequence: mouse sequence GCAGTGGAGGAAATCTCTTTAAGAAAAGG (reverse strand) was replaced with human sequence TCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATA. (J:175778)

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Npm1 Mutation: 36 strains or lines available

References

• Original: J:172071 Vassiliou GS, et al., Mutant nucleophosmin and cooperating pathways drive leukemia initiation and progression in mice. Nat Genet. 2011 May;43(5):470-5
• All: 13 reference(s)