Gt(ROSA)26Sor^{tm7.1(CAG-EGFP/RNAi:Tyr)Maoh}
Targeted Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^{tm7.1(CAG-EGFP/RNAi:Tyr)Maoh}
• Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 7.1, Masato Ohtsuka
• MGI ID: MGI:5056538
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^{tm7.1(CAG-EGFP/RNAi:Tyr)Maoh} page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:173808
• Parent Cell Line: E14TG2a (ES Cell)
• Strain of Origin: 129P2/OlaHsd

Mutation description

• Allele Type: Targeted (Conditional ready, Knockdown, RMCE-ready, Reporter)
• Mutation: Insertion
• Gt(ROSA)26Sor^{tm7.1(CAG-EGFP/RNAi:Tyr)Maoh} involves 1 genes/genome features (Tyr) View all
• Mutation details: Recombinase-mediated cassette exchange (RMCE) replaced the expression cassette between the JT15 and lox2272 sites of Gt(ROSA)26Sor^tm1Maoh with (5' to 3') an IRES, lacZ, polyadenylation sequence, CAG promoter, hygro gene, polyadenylation sequence, FRT site, polyadenylation sequence, and CAG driven fusion of EGFP and a short hairpin RNA targeted to Tyrosinase. The RNAi target sequences within the Tyr gene are "ctggaaggatttgccagtccac"and "gaactgccaatttcagcttta". Flp-mediated recombination removes all but the CAG promoter RNAi construct flanked by an FRT site and the lox2272 site. (J:173808)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 993 strains or lines available

References

• Original: J:173808 Ohtsuka M, et al., Pronuclear injection-based mouse targeted transgenesis for reproducible and highly efficient transgene expression. Nucleic Acids Res. 2010 Dec 1;38(22):e198
• All: 1 reference(s)