Rr249^tm1.1Ebres
Targeted Allele Detail

Summary

• Symbol: Rr249^tm1.1Ebres
• Name: regulatory region 249; targeted mutation 1.1, Emery H Bresnick
• MGI ID: MGI:5466176
• Synonyms: +9.5^-, Gata2^tm1.1Ebres
• Gene: Rr249 Location: unknown Genetic Position: Chr6, Syntenic
• Alliance: Rr249^tm1.1Ebres page

Hemorrhage in Rr249^tm1.1Ebres/Rr249^tm1.1Ebres embryos

Show the 3 phenotype image(s) involving this allele.

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:191756
• Parent Cell Line: CJ9 (ES Cell)
• Strain of Origin: 129S1/Sv-Oca2⁺ Tyr⁺ Kitl⁺

Mutation description

Allele Type: Targeted (Not Applicable) Mutations: Insertion, Intragenic deletion Mutation details: A loxP site flanked neomycin resistance gene cassette replaced the 46 bp E-box GATA motif (CATCTGCAGCCGGTAGATAA; WGATAR) at the +9.5 kb Gata2 enhancer site in intron 4. Cre-mediated recombination removed the neo cassette. RT-PCR confirmed reduced transcript expression in the liver. (J:191756)

Generation of the Rr249^tm1.1Ebres allele

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr249 Mutation: 0 strains or lines available

References

• Original: J:191756 Johnson KD, et al., Cis-element mutated in GATA2-dependent immunodeficiency governs hematopoiesis and vascular integrity. J Clin Invest. 2012 Oct 1;122(10):3692-704
• All: 5 reference(s)