Tyr^em3J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tyr^em3J
• Name: tyrosinase; endonuclease-mediated mutation 3, Jackson
• MGI ID: MGI:5470270
• Gene: Tyr Location: Chr7:87073979-87142637 bp, - strand Genetic Position: Chr7, 49.01 cM
• Alliance: Tyr^em3J page

Mutation origin

• Strain of Origin: C57BL/6NJ

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This zinc finger mediated allele was generated at The Jackson Laboratory and is a 24 bp deletion of AGGGACCACTATTACGTAATCCTG from Chromosome 7 negative strand position 87,483,953 bp through 87,483,976 bp (GRCm38/mm10), which results in a recessive albino phenotype. This is predicted to cause an 8 amino acid in-frame deletion of amino acids 295-302, GPLLRNPG, near the center of the di-copper centre-containing domain, but is not predicted to cause a premature truncation or frameshift. (J:208906)
• Inheritance: Recessive

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tyr Mutation: 379 strains or lines available

References

• Original: J:208906 Murray SA, Endonuclease-induced mutations in tyrosinase. MGI Direct Data Submission. 2014
• All: 1 reference(s)