Gt(ROSA)26Sor^tm2Jake
Targeted Allele Detail

Summary

• Symbol: Gt(ROSA)26Sor^tm2Jake
• Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 2, John A Kessler
• MGI ID: MGI:5474352
• Synonyms: ROSA-MSP
• Gene: Gt(ROSA)26Sor Location: Chr6:113044389-113054205 bp, - strand Genetic Position: Chr6, 52.73 cM
• Alliance: Gt(ROSA)26Sor^tm2Jake page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:192021
• Parent Cell Line: Not Specified (ES Cell)
• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Targeted (Not Applicable)
• Mutation: Insertion
• Mutation details: A cassette, consisting of the CAG (CMV-chicken beta actin) promoter, a splice acceptor site, a floxed pgk-neo stop construct, and the mouse Mir21 sponge sequence, was inserted via homologous recombination. The sponge sequence contained seven Mir21 binding sites (sequence UCAACAUCAGGACAUAAGCUA). This sequence acts as a competitive inhibitor for the microRNA. (J:192021, J:194515)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Gt(ROSA)26Sor Mutation: 993 strains or lines available

References

• Original: J:192021 Bhalala OG, et al., microRNA-21 regulates astrocytic response following spinal cord injury. J Neurosci. 2012 Dec 12;32(50):17935-47
• All: 2 reference(s)