About   Help   FAQ
Arxtm5Kki
Targeted Allele Detail
Summary
Symbol: Arxtm5Kki
Name: aristaless related homeobox; targeted mutation 5, Kunio Kitamura
MGI ID: MGI:5559563
Synonyms: Arx432-455dup, Arx432-455dup24
Gene: Arx  Location: ChrX:92330113-92341963 bp, + strand  Genetic Position: ChrX, 41.05 cM
Alliance: Arxtm5Kki page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:152416
Parent Cell Line:  CCE/EK.CCE (ES Cell)
Strain of Origin:  129S/SvEv-Gpi1c
Mutation
description
Allele Type:    Targeted
Mutations:    Insertion, Single point mutation
 
Mutation detailsExon 2 was replaced with one in which coding nucleotide 437 (T), the second base in valine codon 146 at the start of the second poly-alanine stretch, was replaced with a C and had a duplication of nucleotides coding for poly-alanine sequence inserted after it (c.437T>CGGCTGCCGCCGCTGCCGCTGCAGC). Note that this duplicated sequence cannot be found as a contigous sequence in either C57BL/6J or 129S1/SvImJ, but rather as two separate sequences in two separate poly-alanine stretches in exon 2. This results in a protein with a longer second poly-alanine repeat (p.(V146delinsAAAAAAAAA)). A neomycin resistance cassette was inserted into intron 1. Western blot analysis showed reduced protein expression. (J:152416)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 31 assay results
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Arx Mutation:  20 strains or lines available
References
Original:  J:152416 Kitamura K, et al., Three human ARX mutations cause the lissencephaly-like and mental retardation with epilepsy-like pleiotropic phenotypes in mice. Hum Mol Genet. 2009 Oct 1;18(19):3708-24
All:  6 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory