Arx^tm5Kki
Targeted Allele Detail

Summary

• Symbol: Arx^tm5Kki
• Name: aristaless related homeobox; targeted mutation 5, Kunio Kitamura
• MGI ID: MGI:5559563
• Synonyms: Arx^432-455dup, Arx^432-455dup24
• Gene: Arx Location: ChrX:92330113-92341963 bp, + strand Genetic Position: ChrX, 41.05 cM
• Alliance: Arx^tm5Kki page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:152416
• Parent Cell Line: CCE/EK.CCE (ES Cell)
• Strain of Origin: 129S/SvEv-Gpi1^c

Mutation description

• Allele Type: Targeted
• Mutations: Insertion, Single point mutation
• Mutation details: Exon 2 was replaced with one in which coding nucleotide 437 (T), the second base in valine codon 146 at the start of the second poly-alanine stretch, was replaced with a C and had a duplication of nucleotides coding for poly-alanine sequence inserted after it (c.437T>CGGCTGCCGCCGCTGCCGCTGCAGC). Note that this duplicated sequence cannot be found as a contigous sequence in either C57BL/6J or 129S1/SvImJ, but rather as two separate sequences in two separate poly-alanine stretches in exon 2. This results in a protein with a longer second poly-alanine repeat (p.(V146delinsAAAAAAAAA)). A neomycin resistance cassette was inserted into intron 1. Western blot analysis showed reduced protein expression. (J:152416)

Disease models

Expression

In Mice Carrying this Mutation:	31 assay results
In Structures Affected by this Mutation:	2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Arx Mutation: 20 strains or lines available

References

• Original: J:152416 Kitamura K, et al., Three human ARX mutations cause the lissencephaly-like and mental retardation with epilepsy-like pleiotropic phenotypes in mice. Hum Mol Genet. 2009 Oct 1;18(19):3708-24
• All: 6 reference(s)