Fxn^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fxn^em1(IMPC)J
• Name: frataxin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5571595
• Synonyms: Fxn^em1J
• Gene: Fxn Location: Chr19:24238817-24257969 bp, - strand Genetic Position: Chr19, 19.39 cM, cytoband C1
• Alliance: Fxn^em1(IMPC)J page
• IMPC: Fxn gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Fxn-5659J-106A was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AGTAGCATGTGGGCGTTCGG, which resulted in a 4 bp deletion TTCG in exon 1 beginning at Chromosome 19 negative strand position 24,280,560 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Fxn Mutation: 42 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)