Exoc4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Exoc4^em1(IMPC)J
• Name: exocyst complex component 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5571596
• Synonyms: Exoc4^em1J
• Gene: Exoc4 Location: Chr6:33226025-33950914 bp, + strand Genetic Position: Chr6, 14.59 cM
• Alliance: Exoc4^em1(IMPC)J page
• IMPC: Exoc4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Exoc4-5677J-3730 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACCGAGATGAGCAGCCCCGA, which resulted in a 10 bp deletion GGGGCTGCTC beginning at Chromosome 6 positive strand 33249215 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Exoc4 Mutation: 100 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)