Mpdz^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mpdz^em1(IMPC)J
• Name: multiple PDZ domain crumbs cell polarity complex component; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5571597
• Synonyms: Mpdz^em1J
• Gene: Mpdz Location: Chr4:81196742-81361052 bp, - strand Genetic Position: Chr4, 38.0 cM
• Alliance: Mpdz^em1(IMPC)J page
• IMPC: Mpdz gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Mpdz-5657J-A was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GCAGGATGCTAATGGCCTGC and TGCCAGAGGATCTTTGCCGC, which resulted in a 136 bp deletion of TGTGATTGCCAGAGGATCTTTGCCGCCGGTCTCCAGCCCACGGATTTCCCGCTCTCCATCAGCAGCCAGCACCATTTCAGCCCACTCGAATCCAGTGAGTAGCAGAGGCCCAGGATCGGAAGGTGCCACCTCTGGT and a 29 bp insertion of AATAACCCTAAAAGGTTAAAATATTAAAC in exon 6 beginning at Chromosome 4 negative strand position 81383820 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mpdz Mutation: 79 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)