Mir181d^tm1.1Oers
Targeted Allele Detail

Summary

• Symbol: Mir181d^tm1.1Oers
• Name: microRNA 181d; targeted mutation 1.1, Nicolai S C van Oers
• MGI ID: MGI:5576230
• Synonyms: Mir181d tm1Oers
• Gene: Mir181d Location: Chr8:84905345-84905416 bp, - strand Genetic Position: Chr8, 40.47 cM
• Alliance: Mir181d^tm1.1Oers page

Mutation origin

• Germline Transmission: Earliest citation of germline transmission: J:94077
• Parent Cell Line: Other (see notes) (ES Cell)
• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Targeted (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: The hairpin loopwas eliminated and several additional nucleotides were introduced to create a new Pst I restriction site. The original sequence was acaattaacattcattgttgtcggtgggttg and the new sequence was acaattaagtgctaatgttgtccctgcagtgtg. A floxed neo selection cassette was subsequently removed by cre excision. Northern blot analhysis confirmed the lack of mature transcript without effecting expression of Mir181c. (J:94077, J:212571)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Mir181d Mutation: 1 strain or line available

Notes

ES cell line = LR2.6.1

References

• Original: J:94077 Mutant Mouse Regional Resource Centers, Information obtained from the Mutant Mouse Regional Resource Centers (MMRRC). Unpublished. 2004-2015
• All: 2 reference(s)