Krt77^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Krt77^em1(IMPC)J
• Name: keratin 77; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5576237
• Synonyms: Krt77^em1J
• Gene: Krt77 Location: Chr15:101767166-101778140 bp, - strand Genetic Position: Chr15, 57.08 cM
• Alliance: Krt77^em1(IMPC)J page
• IMPC: Krt77 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele, from project Krt77-5764J-0643, was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CACTGGCACTTCGTCCCACT, which resulted in an 10 bp deletion GTGGGACGAA in exon1 beginning at Chromosome 15 negative strand position 101,869,384 bp (GRCm38) and is predicted to cause amino acid changes after residue 70 and a frameshift mutation with early truncation 68 residues later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Krt77 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)