About   Help   FAQ
Gt(ROSA)26Sortm9(CAG-GFP*)Nat
Targeted Allele Detail
Summary
Symbol: Gt(ROSA)26Sortm9(CAG-GFP*)Nat
Name: gene trap ROSA 26, Philippe Soriano; targeted mutation 9, Jeremy Nathans
MGI ID: MGI:5578178
Synonyms: R26 mLSL-nGFP
Gene: Gt(ROSA)26Sor  Location: Chr6:113044389-113054205 bp, - strand  Genetic Position: Chr6, 52.73 cM
Alliance: Gt(ROSA)26Sortm9(CAG-GFP*)Nat page
Mutation
origin
Germline Transmission:  Earliest citation of germline transmission: J:101977
Parent Cell Line:  Not Specified (ES Cell)
Strain of Origin:  129
Mutation
description
Allele Type:    Targeted (Conditional ready, Reporter)
Mutation:    Insertion
 
Mutation detailsThe targeting vector containins (from 5' to 3') a CAG promoter, a mutant loxP63 (ATAACTTCGTATAGCCTACATTATACGAAGTTAT)-triple poly A/stop-wild type loxP (ATAACTTCGTATAGCATACATTATACGAAGTTAT), a nuclear-localized GFP with a C-terminal 6-myc epitope tag, a bovine growth hormone 3' UTR, and a Frt-PGKneo-Frt cassette. The stop cassette consists of three tandem SV40 polyadenylation/transcription termination sequences. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Gt(ROSA)26Sor Mutation:  958 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory