Eogt^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Eogt^em1(IMPC)J
• Name: EGF domain specific O-linked N-acetylglucosamine transferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5578313
• Synonyms: Eogt^em1J
• Gene: Eogt Location: Chr6:97086985-97126143 bp, - strand Genetic Position: Chr6, 44.88 cM
• Alliance: Eogt^em1(IMPC)J page
• IMPC: Eogt gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Eogt-5785J-8958 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTGAGGCTGACGATGCGCC, which resulted in a 25 bp deletion AGGCTGACGATGCGCCTGGCAAGGC in exon 4 beginning at Chromosome 6 negative strand position 97145373 bp (GRCm38) and is predicted to cause a frameshift mutation with early truncation. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Eogt Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)