Bmp2k^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Bmp2k^em1(IMPC)J
• Name: BMP2 inducible kinase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5584154
• Synonyms: Bmp2k^em1J
• Gene: Bmp2k Location: Chr5:97145548-97239726 bp, + strand Genetic Position: Chr5, 47.29 cM, cytoband E3
• Alliance: Bmp2k^em1(IMPC)J page
• IMPC: Bmp2k gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Bmp2k-5786J-8977 was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and left guide sequence GGCGAACACCCGGACCCCCA and right guide sequence CGGCCGCTACCAGGTCACCC, which resulted in an 163 bp deletion in exon1 beginning at CGCGGGCGGCGGGCTCGGCGGCG at Chromosome 5 positive strand position 96,997,992 bp (GRCm38/mm10) and extending through CGGGGTGTGGCGGCGGCTGCGGGGCC at 96,998,155 bp and is predicted to cause a frameshift mutation with early truncation. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Bmp2k Mutation: 38 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)