Iqcj^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Iqcj^em1(IMPC)J
• Name: IQ motif containing J; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5585265
• Synonyms: Iqcj^em1J
• Gene: Iqcj Location: Chr3:67799553-67963926 bp, + strand Genetic Position: Chr3, 31.31 cM
• Alliance: Iqcj^em1(IMPC)J page
• IMPC: Iqcj gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Iqcj-5923J-4293 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCTTTAGAACAAGTTGACGA, which resulted in an 11 bp deletion AACAAGTTGAC in exon 2 beginning at Chromosome 3 positive strand position 68041225 bp (GRCm38) and a 6 bp insertion TAAATG. This mutation is predicted to cause amino acid sequence changes after residue 13 and an early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Iqcj Mutation: 6 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)