About   Help   FAQ
Zfyve26em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfyve26em1(IMPC)J
Name: zinc finger, FYVE domain containing 26; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5585269
Synonyms: Zfyve26em1J
Gene: Zfyve26  Location: Chr12:79279120-79343078 bp, - strand  Genetic Position: Chr12, 35.51 cM
Alliance: Zfyve26em1(IMPC)J page
IMPC: Zfyve26 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Zfyve26-5939J-1816 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGAGGACATACTACAGGCGC, which resulted in an 11 bp deletion ATACTACAGGC in exon 2 beginning at Chromosome 12 negative strand position 79295514 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and an early truncation 57 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Zfyve26 Mutation:  106 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory