Zfyve26^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfyve26^em1(IMPC)J
• Name: zinc finger, FYVE domain containing 26; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5585269
• Synonyms: Zfyve26^em1J
• Gene: Zfyve26 Location: Chr12:79279120-79343078 bp, - strand Genetic Position: Chr12, 35.51 cM
• Alliance: Zfyve26^em1(IMPC)J page
• IMPC: Zfyve26 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Zfyve26-5939J-1816 was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GGAGGACATACTACAGGCGC, which resulted in an 11 bp deletion ATACTACAGGC in exon 2 beginning at Chromosome 12 negative strand position 79295514 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 52 and an early truncation 57 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Zfyve26 Mutation: 106 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)