Myh10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myh10^em1(IMPC)J
• Name: myosin, heavy polypeptide 10, non-muscle; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5604248
• Synonyms: Myh10^em1J
• Gene: Myh10 Location: Chr11:68582385-68707458 bp, + strand Genetic Position: Chr11, 41.95 cM, cytoband B3
• Alliance: Myh10^em1(IMPC)J page
• IMPC: Myh10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Myh10-6078J-P4M2R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GTCCACAAAGAGATACCTCT, which resulted in a 4 bp deletion GGTA in exon 2 beginning at Chromosome 11 positive strand position 68699275bp (GRCm38) and is predicted to cause amino acid sequence changes after residue 11 and an early truncation 66 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Myh10 Mutation: 95 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)