Adad2^em3(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adad2^em3(IMPC)J
• Name: adenosine deaminase domain containing 2; endonuclease-mediated mutation 3, Jackson
• MGI ID: MGI:5604765
• Synonyms: Adad2^em3
• Gene: Adad2 Location: Chr8:120339486-120343663 bp, + strand Genetic Position: Chr8, 68.05 cM, cytoband E1
• Alliance: Adad2^em3(IMPC)J page
• IMPC: Adad2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence CCCATGCTCAGCGGTCCTAG which resulted in this single base pair (G) deletion at Chr 8 position 119,612,906 bp (J:188991, J:294176)

Expression

In Mice Carrying this Mutation:	9 assay results 2 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Adad2 Mutation: 19 strains or lines available

References

• Original: J:294176 Snyder E, et al., ADAD1 and ADAD2, testis-specific adenosine deaminase domain-containing proteins, are required for male fertility. Sci Rep. 2020 Jul 14;10(1):11536
• All: 2 reference(s)