Dolk^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dolk^em1(IMPC)J
• Name: dolichol kinase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5605979
• Synonyms: Dolk^-, Dolk^em1J
• Gene: Dolk Location: Chr2:30174243-30176346 bp, - strand Genetic Position: Chr2, 21.49 cM
• Alliance: Dolk^em1(IMPC)J page
• IMPC: Dolk gene page

Dolk^em1(IMPC)J/Dolk^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller, with a rudimentary egg cylinder, and failure of primitive streak formation and gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dolk-5942-1899 was generated at The Jackson Laboratory by injecting Cas9 D10 (nickase) RNA and guide sequences CGTAGAAGGCCTGCACCGCG and ACGTCCAGTACAAGTGGGAC, which resulted in a 25 bp deletion in exon 1 beginning at Chromosome 2 negative strand position 30285881 (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 50 and early truncation 32 amino acids later. (J:188991)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dolk Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)