Ttll10^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttll10^em1(IMPC)J
• Name: tubulin tyrosine ligase-like family, member 10; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5607785
• Synonyms: Ttll10^em1J
• Gene: Ttll10 Location: Chr4:156119292-156135274 bp, - strand Genetic Position: Chr4, 87.82 cM, cytoband E2
• Alliance: Ttll10^em1(IMPC)J page
• IMPC: Ttll10 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ttll10-5999J-P5ML was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence AAAGATGGCCCTACACCCAC, which resulted in an 8 bp deletion CACAGGCC in exon3 beginning at Chromosome 4 negative strand position 156,048,583 bp (GRCm38), which is predicted to cause amino acid sequence changes after residue 4 and early truncation 72 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ttll10 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)