About   Help   FAQ
Pcdh12em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdh12em1(IMPC)J
Name: protocadherin 12; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5607865
Synonyms: Pcdh12em1J
Gene: Pcdh12  Location: Chr18:38400145-38417454 bp, - strand  Genetic Position: Chr18, 20.17 cM, cytoband B3
Alliance: Pcdh12em1(IMPC)J page
IMPC: Pcdh12 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Pcdh12-6034J-P3MB was generated at The Jackson Laboratory by injecting Cas9 nickase RNA and guide sequences GTAGCATCATGCTTACCGGC and CATTCCTGCTAGGGCTCTTA, which resulted in a 38 bp deletion GCCATTCCTGCTAGGGCTCTTAGGGCCAGGAAGCTACT in exon1 beginning at Chromosome 18 negative strand position 38,284,057 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 5 and early truncation 63 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pcdh12 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory