Smg9^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Smg9^em1(IMPC)J
• Name: SMG9 nonsense mediated mRNA decay factor; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5616624
• Synonyms: Smg9^em1J
• Gene: Smg9 Location: Chr7:24099106-24122197 bp, + strand Genetic Position: Chr7, 10.54 cM
• Alliance: Smg9^em1(IMPC)J page
• IMPC: Smg9 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Hypomorph)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Smg9-6001-MP6R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TCTACGGGATAGAGCGGCGG, which resulted in a 2 bp deletion GG and a 10 bp insertion CTGGGTTCTA in exon 2 beginning at Chromosome 7 positive strand approximate position 24,403,446 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 15 and early truncation 88 amino acids later. QRT-PCR confirmed a severe reduction in transcript expression. (J:188991, J:231968)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Smg9 Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)