Prss56^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prss56^em1(IMPC)J
• Name: serine protease 56; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5616626
• Synonyms: Prss56^em1J
• Gene: Prss56 Location: Chr1:87111035-87116127 bp, + strand Genetic Position: Chr1, 44.07 cM, cytoband C5
• Alliance: Prss56^em1(IMPC)J page
• IMPC: Prss56 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Insertion
• Mutation details: This allele from project Prss56-6052-104P4MB was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCCCCAGGTCACCATGCCGC, which resulted in a 1 bp insertion (G) after exon1 beginning at Chromosome 1 positive strand position 87183497 bp (GRCm38), which is after the sequence GGTCACCATGC. This mutation is predicted to cause amino acid sequence changes after residue 2 and early truncation 66 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Prss56 Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)