Nxn^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nxn^em1(IMPC)J
• Name: nucleoredoxin; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5620177
• Synonyms: Nxn^em1J
• Gene: Nxn Location: Chr11:76148052-76289967 bp, - strand Genetic Position: Chr11, 45.92 cM
• Alliance: Nxn^em1(IMPC)J page
• IMPC: Nxn gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Nxn-6439J-FP22R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences GCGTCTAGGAATATTAGCGA, ACTCTGCAATTAATTTGGTT and TGACCCGGAAGGTAAGGCTT which resulted in a 5 bp deletion ATCGC in exon 2 beginning at Chromosome 11 negative strand position 76278553bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 133 and early truncation 21 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nxn Mutation: 502 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)