About   Help   FAQ
Ddx59em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ddx59em1(IMPC)J
Name: DEAD box helicase 59; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5620213
Synonyms: Ddx59-, Ddx59em1J
Gene: Ddx59  Location: Chr1:136343009-136367896 bp, + strand  Genetic Position: Chr1, 59.73 cM, cytoband F
Alliance: Ddx59em1(IMPC)J page
IMPC: Ddx59 gene page
Ddx59em1(IMPC)J/Ddx59em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E7.5 but not at E9.5. Embryos are smaller, with a rudimentary egg cylinder, and failure of primitive streak formation and gastrulation.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ddx59-6150J-MP92R was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence GCAGCAAGTGCTTGACGTTT, which resulted in an 8 bp deletion TTGACGTT in exon 5 beginning at Chromosome 1 positive strand position 136432352bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 368 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 3 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ddx59 Mutation:  83 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory