Pigc^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pigc^em1(IMPC)J
• Name: phosphatidylinositol glycan anchor biosynthesis, class C; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5629300
• Synonyms: Pigc^em1J
• Gene: Pigc Location: Chr1:161796755-161801004 bp, + strand Genetic Position: Chr1, 69.95 cM
• Alliance: Pigc^em1(IMPC)J page
• IMPC: Pigc gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Pigc-6237J-103MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequences TGTAGTGATCTGGTGGTACA and CCCCAGTGGCTTTTTGGGAC, which resulted in a 1 bp deletion, T, in exon1 at Chromosome 1 positive strand position 161,970,654 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 67 and early truncation 1 amino acid later. There is an additional 11 bp deletion, tggctccccag, 34 bp after the 1 bp deletion, in exon 1 beginning at Chromosome 1 positive strand position 161,970,689. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Pigc Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)