About   Help   FAQ
Ubn1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ubn1em1(IMPC)J
Name: ubinuclein 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5629302
Synonyms: Ubn1em1J
Gene: Ubn1  Location: Chr16:4867921-4904153 bp, + strand  Genetic Position: Chr16, 2.49 cM
Alliance: Ubn1em1(IMPC)J page
IMPC: Ubn1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Ubn1-6239J-105P8MR was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence ACGTAGGAAAGACCGAATAC which resulted in a 7 bp deletion ACCGAAT in exon 5 beginning at Chromosome 16 positive strand position 5,062,557 - 5,062,563 bp (GRCm38) that is predicted to cause amino acid sequence changes after residue 121 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Ubn1 Mutation:  45 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory