Orc6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Orc6^em1(IMPC)J
• Name: origin recognition complex, subunit 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5638892
• Synonyms: Orc6^-, Orc6^em1J
• Gene: Orc6 Location: Chr8:86026261-86034907 bp, + strand Genetic Position: Chr8, 41.61 cM, cytoband C3
• Alliance: Orc6^em1(IMPC)J page
• IMPC: Orc6 gene page

Orc6^em1(IMPC)J/Orc6^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida with apparent cell death and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Orc6-6540J-8033M was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CATCTGTTCAGCAGTAAATG, AACTGCATCCGGTGTGAAAA and TACTAAACCACTTTATTCGC (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 435bp deletion beginning in intron 4 at CTCATTTACTGCTGAACAGATGAA at Chromosome 8 positive strand position 85,305,411 bp (GRCm38) and ending after CTGCGAATAAAGTGGTTTAGTAC at position 85,305,411 bp in intron 5. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 150 and early truncation 6 amino acids later. PCR failed to detect the insertion of any loxP sites. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Orc6 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)