Ap4e1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ap4e1^em1(IMPC)J
• Name: adaptor-related protein complex AP-4, epsilon 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5638898
• Synonyms: Ap4e1^em1J
• Gene: Ap4e1 Location: Chr2:126850637-126909829 bp, + strand Genetic Position: Chr2, 61.76 cM
• Alliance: Ap4e1^em1(IMPC)J page
• IMPC: Ap4e1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Ap4e1-6638-2877F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, GCAATCAAGTTGGCCCAACA, TGTCCTGACTGTCGTTTTTA and CTGTTTGTTTACATAGTGAT which resulted in a 1bp insertion A in exon 3 beginning at Chromosome 2 positive strand position 127,014,235 bp (GRCm38). This mutation is predicted to cause amino acid sequence changes after residue 105 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ap4e1 Mutation: 59 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)