Trip13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Trip13^em1(IMPC)J
• Name: thyroid hormone receptor interactor 13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5639079
• Synonyms: Trip13^em1J
• Gene: Trip13 Location: Chr13:74060577-74085855 bp, - strand Genetic Position: Chr13, 40.15 cM, cytoband C1
• Alliance: Trip13^em1(IMPC)J page
• IMPC: Trip13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Trip13-6637J-2781F was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CACTAAAGTATAGCTAGGTC, TTGTGTTTGGAGATTACGTC and CGGGTTACTACCCTATCTGT which resulted in a 556bp deletion beginning in intron 1 at CTAGCTATACTTTAGTGGG at Chromosome 13 negative strand position 73,936,559 bp (GRCm38) and ending after TAGCGGGTTACTACCCTATC at position 73,936,004 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 31 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Trip13 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)