Dock6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dock6^em1(IMPC)J
• Name: dedicator of cytokinesis 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5639331
• Synonyms: Dock6^em1J
• Gene: Dock6 Location: Chr9:21711476-21764006 bp, - strand Genetic Position: Chr9, 7.89 cM, cytoband A4
• Alliance: Dock6^em1(IMPC)J page
• IMPC: Dock6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dock6-6207J-FP2B was generated at The Jackson Laboratory by injecting Cas9 RNA and guide sequence TGGTGACAGTTAACGTGGCC, which resulted in a 145 bp deletion and a T insertion in exon12 beginning at Chromosome 9 negative strand position 21,839,387 bp, CGGCCACGTTAACTGTCACCA, and ending after TACCTTGGGGAATCTGTATC at 21,839,244 bp (GRCm38/mm10). This mutation deletes the last 34 bp of coding sequence in exon 12, 111 bp in intron 13 as well as the splice donor and is predicted to result in a read through into exon 13 causing amino acid sequence changes after residue 448 and early truncation 26 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dock6 Mutation: 153 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)