About   Help   FAQ
Prkab1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Prkab1em1(IMPC)J
Name: protein kinase, AMP-activated, beta 1 non-catalytic subunit; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5642073
Synonyms: Prkab1em1J
Gene: Prkab1  Location: Chr5:116151654-116162449 bp, - strand  Genetic Position: Chr5, 56.1 cM, cytoband F
Alliance: Prkab1em1(IMPC)J page
IMPC: Prkab1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from project Prkab1-6663J-9043 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: CCTGTCCATCGAAACACGGT, AGAGGCGTTTACTTGGGGTCAGG, and CCGAGATCCTTACCTTCTCG, which resulted in a 208 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 116,021,672 bp at CCCAAGTAAACGCCTCTGCTT and ending after AGGTAAGGATCTCGGCGGAC at 116,021,465 bp (GRCm38). This mutation deletes exon2 and is predicted to cause amino acid sequence changes after residue 53 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Prkab1 Mutation:  24 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
11/12/2024
MGI 6.24
The Jackson Laboratory