Prkab1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prkab1^em1(IMPC)J
• Name: protein kinase, AMP-activated, beta 1 non-catalytic subunit; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5642073
• Synonyms: Prkab1^em1J
• Gene: Prkab1 Location: Chr5:116151654-116162449 bp, - strand Genetic Position: Chr5, 56.1 cM, cytoband F
• Alliance: Prkab1^em1(IMPC)J page
• IMPC: Prkab1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Prkab1-6663J-9043 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: CCTGTCCATCGAAACACGGT, AGAGGCGTTTACTTGGGGTCAGG, and CCGAGATCCTTACCTTCTCG, which resulted in a 208 bp deletion in exon 2 beginning at Chromosome 5 negative strand position 116,021,672 bp at CCCAAGTAAACGCCTCTGCTT and ending after AGGTAAGGATCTCGGCGGAC at 116,021,465 bp (GRCm38). This mutation deletes exon2 and is predicted to cause amino acid sequence changes after residue 53 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prkab1 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)