Tmco1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tmco1^em1(IMPC)J
• Name: transmembrane and coiled-coil domains 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5642374
• Synonyms: Tmco1^em1J
• Gene: Tmco1 Location: Chr1:167136239-167161547 bp, + strand Genetic Position: Chr1, 74.69 cM
• Alliance: Tmco1^em1(IMPC)J page
• IMPC: Tmco1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Tmco1-6660J-M1122 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, ATAAGACGAAGTGAATATGT and CAACAATAGAGACCTGTCAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 281bp deletion beginning in intron 3 at TATTCACTTCGTCTTATTGA at Chromosome 1 positive strand position 167,316,119 bp (GRCm38) and ending after AGTTCTTAAAATGTATTACCT at position 167,316,399 bp in intron 4. This mutation deletes exon 4 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tmco1 Mutation: 43 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)