Med20^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Med20^em1(IMPC)J
• Name: mediator complex subunit 20; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5643678
• Synonyms: Med20^-, Med20^em1J
• Gene: Med20 Location: Chr17:47922510-47935176 bp, + strand Genetic Position: Chr17, 23.66 cM
• Alliance: Med20^em1(IMPC)J page
• IMPC: Med20 gene page

Med20^em1(IMPC)J/Med20^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Blastocysts grown in vitro fail to hatch from the zona pellucida.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Med20-6705J-M5886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences, AGGAACTCTTGGGGACTGAT and GCTTAGAGTATTTACGTTAA (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 348bp deletion beginning in intron 1 at GGGGACTGATGGGTGGGGAT at Chromosome 17 positive strand position 47,612,827 bp (GRCm38) and ending after GCTTAGAGTATTTACGTTAAT at position 47,613,174 bp in intron 2. This mutation deletes exon 2 and is predicted to cause amino acid sequence changes after residue 4 and early truncation 11 amino acids later. PCR failed to detect the insertion of any loxP sites. RT-PCR analysis confirmed the absence of mRNA expression in homozygous mutant blastocysts. (J:188991, J:286962)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	4 assay results
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Med20 Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)