Klra7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klra7^em1(IMPC)J
• Name: killer cell lectin-like receptor, subfamily A, member 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5644523
• Synonyms: Klra7^em1J
• Gene: Klra7 Location: Chr6:130195568-130210285 bp, - strand Genetic Position: Chr6, 63.44 cM
• Alliance: Klra7^em1(IMPC)J page
• IMPC: Klra7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Klra7-6781J-M7991 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences: TCTTGTACTTGTGCATAACC, CAGTCCTCACTAGTTTCTGC and GACATGGACTGACCAAATT which resulted in a 241 bp deletion beginning in 5 upstream sequence at Chromosome 6 negative strand position 130,231,784 bp, beginning TCAGGGTGTTTATAGCATTAAG, and ending after GTTGCAGAAACTAGTGAGGAC in exon 1 at 130,231,544 bp (GRCm38/mm10). This mutation deletes the 5-prime UTR region and part of exon 1 and is predicted to not produce a protein product. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Klra7 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)