Kcnd3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnd3^em1(IMPC)J
• Name: potassium voltage-gated channel, Shal-related family, member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5644712
• Synonyms: Kcnd3^em1J
• Gene: Kcnd3 Location: Chr3:105359646-105581318 bp, + strand Genetic Position: Chr3, 46.32 cM, cytoband F3
• Alliance: Kcnd3^em1(IMPC)J page
• IMPC: Kcnd3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Kcnd3- 6780J-M7405 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, TGTTCGAGCAAGTGAGTGAT, TGGTGCCTAAGACAATCGCA and GCATGGACGTCCTCTCACT which resulted in a 327bp deletion beginning in intron 3 at GTTTCCCACATGGCCTCTTA at Chromosome 3 positive strand position 105,658,545 bp (GRCm38) and ending after TAAGTAAGAGGCCATGTGGGAAAC at position 105,658,871 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 369 and early truncation 32 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Kcnd3 Mutation: 62 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 5 reference(s)