Olfml2b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Olfml2b^em1(IMPC)J
• Name: olfactomedin-like 2B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5644713
• Synonyms: Olfml2b^em1J
• Gene: Olfml2b Location: Chr1:170472101-170510356 bp, + strand Genetic Position: Chr1, 76.95 cM
• Alliance: Olfml2b^em1(IMPC)J page
• IMPC: Olfml2b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Olfml2b-6834J-F3656 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, ATACAGTCGCACTTCCCAAG, AATCACCTACTATAAAGCCA and GGGATTTCATCCTTAGTGCA which resulted in a 390bp deletion beginning in intron 5 at GGCCCTCTTGGGAAGTGCGACTGTAT at Chromosome 1 positive strand position 170,666,451 bp (GRCm38) and ending after TCAGGGATTTCATCCTTAGTGCAG at position 170,666,840 bp in intron 6. This mutation deletes exon 5 and is predicted to cause amino acid sequence changes after residue 241 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Olfml2b Mutation: 37 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)