Serpina3n^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Serpina3n^em1(IMPC)J
• Name: serine (or cysteine) peptidase inhibitor, clade A, member 3N; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5644715
• Synonyms: Serpina3n^em1J
• Gene: Serpina3n Location: Chr12:104372988-104380588 bp, + strand Genetic Position: Chr12, 54.17 cM, cytoband F1
• Alliance: Serpina3n^em1(IMPC)J page
• IMPC: Serpina3n gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele from project Serpina3n-6845J-M9384 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guides sequences, CTCAGAAGCGGTGTTAACTG, AGTGCCCATGATGAGCATGG and CCTGTTCTGTCCTCAGCCTA which resulted in a 402 bp deletion and an 8 bp insertion (ACAGTGTA) in intron 3 at Chromosome 12 positive strand position 104,411,059 bp (TAACTGAGGAGAAGGTGGAGTCTCTG in GRCm38) and ending after CTGTTCTGTCCTCAGCCTAAGGCC at position 104,411,460 bp in intron 4. This mutation deletes exon 3 and is predicted to cause amino acid sequence changes after residue 212 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Serpina3n Mutation: 32 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)