Dbn1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dbn1^em1(IMPC)J
• Name: drebrin 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:5645712
• Synonyms: Dbn1^em1J
• Gene: Dbn1 Location: Chr13:55621241-55635874 bp, - strand Genetic Position: Chr13, 30.06 cM
• Alliance: Dbn1^em1(IMPC)J page
• IMPC: Dbn1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project Dbn1-6662J-M9006 was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences, CCTACACCCGTCACCCTGCA, TGACGCTGCAGAAACCATAC and GGTGGAATGTGGCCGCTCCG, (along with a plasmid containing 1 kb homology arms flanking the floxed critical exon, which did not integrate) which resulted in a 108bp deletion beginning in intron 3 at GTAGGAGATGGGGAGTCCCAA at Chromosome 13 negative strand position 55,482,845 bp (GRCm38) and ending after ATGTATGGTTTCTGCAGCGT at position 55,482,738 bp in exon 3. This mutation deletes part of exon 3 and is predicted to cause amino acid sequence changes after residue 47 and early truncation 46 amino acids later. This allele also has an additional 48bp deletion in intron 4 from Chromosome 13 negative strand position 55,482,666 bp to 55,482,619 bp, which is not expected to affect the protein. PCR failed to detect the insertion of any loxP sites. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dbn1 Mutation: 44 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)